Design and Specificity Test of Specific Primers for Neuroglobin Gene Expression Modulation in Brain Tissue of Rattus norvegicus using qRT-PCR
Abstract
Neuroglobin (Ngb) is a newly discovered globin that is found in large numbers in neurons. Brain cells are very sensitive to lack of oxygen and can begin to die within five minutes after the oxygen supply is cut off. hypoxic conditions of brain tissue are ischemic in the area of the bleeding center. This study aims to design and analyze the expression of the Neuroglobin Rattus norvegicus mRNA gene in silico as a nucleotide that is able to read neuroglobin gene expression due to hypoxic states. The neuroglobin gene sequence was obtained using a "nucleotide" search menu provided by NCBI GenBank and designed using Geneious Prime bioinformatics software. The neuroglobin gene sequence used in this study was Rattus norvegicus mRNA with accession number NM_033359.3|:1-1,773. Synthesized primary pairs are optimized using PCR gradients. PCR products were analyzed by electrophoresis using 1.5% agarose gel, 100 V for 27 minutesThe results obtained one forward primer for Rattus norvegicus neuroglobin (Ngb) which has a length of 20 bases with the order of 5' AGTCTTAGCCTCTCCCCCAG -3' and reverse primer has a length of 20 bases with the order of 5' GTCTACAGAACCACGGCACAcx-3' product size 803 bp. The difference Tm in this pair of primers is 0.9 0C. The gradient PCR results showed the thickest and clearest DNA bands were at 57.7°C. Primers with the best primary criteria for neuroglobin genes were obtained with an amplicon size of 803 bp and an aneealing temperature of 57.7 °C. The design results meet the requirements of good criteria so that the primary candidate design results can be used for the PCR process.
Keywords
Full Text:
PDF (Bahasa Indonesia)References
Acker, T., & Acker, H. (2004). Cellular oxygen sensing need in CNS function: Physiological and pathological implications. In Journal of Experimental Biology (Vol. 207, Issue 18, pp. 3171–3188). https://doi.org/10.1242/jeb.01075
Achyar, A., Atifah, Y., Putri, D.H., 2021. In silico study of developing a method for detecting pathogenic bacteria in refillable drinking water samples. Journal of Physics: Conference Series 1940 (1): 012061.
Azevedo, F. A. C., Carvalho, L. R. B., Grinberg, L. T., Farfel, J. M., Ferretti, R. E. L., Leite, R. E. P., Filho, W. J., Lent, R., & Herculano-Houzel, S. (2009). Equal numbers of neuronal and nonneuronal cells make the human brain an isometrically scaled-up primate brain. Journal of Comparative Neuro
Borah, P., 2011. Primer Designing for PCR. Science Vision 11(3): 134 -136. logy, 513(5), 532–541. https://doi.org/10.1002/cne.21974
Burmester, T., Weich, B., Reinhardt, S., & Hankeln, T. (2000). A vertebrate globin expressed in the brain. Nature, 407(6803), 520–523. https://doi.org/10.1038/35035093
Carmody, R. N., & Wrangham, R. W. (2009). The energetic significance of cooking. Journal of Human Evolution, 57(4), 379–391. https://doi.org/10.1016/j.jhevol.2009.02.011
Dewilde, S., Kiger, L., Burmester, T., Hankeln, T., Baudin-Creuza, V., Aerts, T., Marden, M. C., Caubergs, R., & Moens, L. (2001). Biochemical Characterization and Ligand Binding Properties of Neuroglobin, a Novel Member of the Globin Family. Journal of Biological Chemistry, 276(42), 38949–38955. https://doi.org/10.1074/jbc.M106438200
Farma, S.A., Handayani, D. and Putri, D.H., 2020, August. Optimization of Annealing Temperature of HIF-1 A and 18s rRNA in Blood of Swimming Athletes Using RT-PCR. In International Conference on Biology, Sciences and Education (ICoBioSE 2019) (pp. 34-38). Atlantis Press.
Hundahl, C., Kelsen, J., Kjær, K., Rønn, L. C. B., Weber, R. E., Geuens, E., Hay-Schmidt, A., & Nyengaard, J. R. (2006). Does neuroglobin protect neurons from ischemic insult? A quantitative investigation of neuroglobin expression following transient MCAo in spontaneously hypertensive rats. Brain Research, 1085(1), 19–27. https://doi.org/https://doi.org/10.1016/j.brainres.2006.02.040
Kadri, K. (2020). Polymerase Chain Reaction (PCR): Principle and Applications. Synthetic Biology-New Interdisciplinary Science, 147–164.
Lorenz, T., 2012. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. JoVE Journal of visualized experiments. 63, 1–15. doi: https://doi.org/10.3791/3998
Praja, R. K. (2021). In silico oligonucleotide primer design for Campylobacter jejuni cytolethal distending toxin B gene amplification. Oceana Biomedicina Journal, 53–65. https://doi.org/https://doi.org/10.30649/ OBJ.V4I1.88.
Reuss, S., Saaler-Reinhardt, S., Weich, B., Wystub, S., Reuss, M. H., Burmester, T., & Hankeln, T. (2002). Expression analysis of neuroglobin mRNA in rodent tissues. Neuroscience, 115(3), 645–656. https://doi.org/https://doi.org/10.1016/S0306-4522(02)00536-5
Saraswati, H., Seprianto, Wahyuni, F. D., 2019. Desain primer secara in silico untuk amplifikasi gen cryIII dari Bacillus thuringiensis isolat lokal. Indonesian Journal of Biotechnology and Biodiversity, 3(1),
Sasmito, D. E. K., Kurniawan, R., Muhimmah, I., 2014. Karakteristik primer pada polymerase chain reaction (PCR) untuk sekuensing DNA: mini review. Seminar Nasional Informatika Medis (SNIMed) V, (5), 93–102. Magister Teknik Informatika, Fakultas Teknologi Industri, Universitas Islam Indonesia. 33– 38.
Shang, A., Zhou, D., Wang, L., Gao, Y., Fan, M., Wang, X., Zhou, R., & Zhang, C. (2006). Increased neuroglobin levels in the cerebral cortex and serum after ischemia–reperfusion insults. Brain Research, 1078(1), 219–226. https://doi.org/https://doi.org/10.1016/j.brainres.2006.01.064
Sint, D., Raso, L., & Traugott, M. (2012). Advances in multiplex PCR: balancing primer efficiencies and improving detection success. Methods in Ecology and Evolution, 898–905.
Sun, Y., Jin, K., Mao, X. O., Zhu, Y., & Greenberg, D. A. (2001). Neuroglobin is up-regulated by and protects neurons from hypoxic-ischemic injury. www.pnas.orgcgidoi10.1073pnas.251466698
Sun, Y., Jin, K., Peel, A., Mao, X. O., Xie, L., & Greenberg, D. A. (2003). Neuroglobin protects the brain from experimental stroke in vivo. www.pnas.orgcgidoi10.1073pnas.0637726100
Ye, J., Coulouris, G., Zaretskaya, I., Cutcutache, I., Rozen, S., Madden, T. L., 2012. PrimerBLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics, 13(134), 1–11. https://doi. org/10.1186/1471-2105-13-134
DOI: https://doi.org/10.24036/bsc.v7i2.125246
Refbacks
- There are currently no refbacks.
Copyright (c) 2023 Bintang Fadhil Ramadhan, Muhammad Farikh, Muhammad Naufal Arrafi, Nagra Aulia Valofi, Walidatul Awaliyah, Jessi Rizkanauli Simangungsong, Dini Herisanti, Siska Alicia Farma
This work is licensed under a Creative Commons Attribution 4.0 International License.
Bioscience is Indexed By:
